KnE Life Sciences | The UGM Annual Scientific Conference Life Sciences 2016 | pages: 67–75

, , , , , , and

1. Introduction

NPC is happening by insertion of EBV-DNA viruses. EBV infects B lymphocyte by expressed the LMP1 (oncogene) to increase B-cell proliferation by making a similar signal to activated B-cell by upper cell molecule B-cell, CD40. In another hand, LMP-1 is prevented apoptosis by activated BCL2. Then, the proliferation will be uncontrolled [1]. To achieve long-term in vivo, the EBV express the latent gene which causes latent infection [2].

The drugs of choice in NPC therapy was cisplatin, an inorganic metal drugs as an alkylating agent. As an alkylating agent, it works by inhibiting cross-linking in the N7 alkyl group of guanines and makes uncoil strand [3]. The issue of drugs resistance in cancer therapy have been investigated after cisplatin therapy [4]. Molecular mechanism of cisplatin resistance has been investigated caused by a kinase, such as Akt and YAP1. Alteration of the kinase expressions has been influenced by the expression of a tumor suppressor gene. MicroRNA, the single-strand non-coding RNA has been worked in post-transcriptional mechanism and could be suppressed the expression of tumor suppressor gene [5].

miR-141 have been investigated in NPC proliferation cells by downregulated PTEN, a tumor suppressor gene as an antagonist in the AKT/PI3K pathway [6]. miR-141 have been investigated a role in resistance to cisplatin in esophageal squamous cell carcinoma by targeting YAP1 [7]. In ovarian cancer have been investigated the role of miR-141 in cisplatin resistance by targeting KEAP1 [8]. Induction of NPC in Akt/FoxO pathway is known to lead to their resistance to cisplatin [9].

A research study in NPC cells has investigated the role of miR-141 and mRNA PTEN in NPC pathogenesis. miR-141 has been investigated as oncomiR and mRNA PTEN was targetted [6]. In order to support the noninvasive biomarker agent in drugs resistance, research on miR-141 and mRNA PTEN expression was conducted in blood plasma of NPC patients. At the same time, inhibition of EBV-miR to mRNA PTEN also done to investigate the miRNA-miRNA interaction by in silico study.

2. Materials and Methods

Sample collections

Sample collections used was some blood patients with NPC (pre and post therapy) and plasma of normal people from Dharmais Cancer Hospital and diagnoses of NPC has been done by Cita Herawati. All sample experiments were approved by the ethical committee of Faculty of Medicine, Public Health and Nursing, Universitas Gadjah Mada.

Material

Equipment

Micropipet tube, microRNA mini spin column BF (Exiqon), vortex, centrifuge, spin down, thermal cyder Biorad c1000, qRT-PCR Biorad.

Material

Alcohol 70 %, isopropanol p.a, rDNAse, miRCURY RNA isolation kit- Biofluid Exiqon (Lysis solution BF, Protein precipitation solution BF, Wash solution 1 dan 2 BF, RNAse free water), kit universal cDNA synthesis kit II, 8-64 rxns (cat no. 2-33-1, exiqon), 5 times of reaction buffer, nuclease free water, spike in (Sp6), enzyme mix, ice pack. miRCURY LNA Universal RT micro RNA PCR, LNA PCR Primer Set, hsa-miR-141-3p UAACACUGUCUGGUAAAGAUG

For mRNA: KAPA SYBRⓇ FAST One-Step qRT-PCR Kit Universal (KAPA SYBR FAST qPCR master mix, ROX Reference Dye High, ROX Reference Dye Low, dUTP, KAPA RT mix), primer set mRNA PTEN (forward: GGGTCTGAGTCGCCTGTCA, reverse: CCGTGTTGGAGGCAGTAGAAG), primer beta-actin (forward: GGGAATTCAAAACTGGAACGGTGAAGG, reserve: GGAAGCTTATCAAAGTCCTCGGCCACA). The primer of mRNA PTEN was available from Vinciguerra, et al.[10].

Methods

Plasma isolation

Blood sample in vacutainer EDTA has been centrifuged at 1 500 rad · s -1 in 10 min and collect the plasma. Total RNA from blood plasma was extracted using the miRCURY RNA Isolation Kit-Biofluid (Cat No. 300112, Exiqon). Complementary DNA was prepared from DNAse-treated RNA samples with Universal cDNA Synthesis kit II, 8-64 rxns (Cat. No. 203301, Exiqon). Quantitative PCR was performed on a StepOnePlus real-time PCR system (Applied Biosystems) using Exilent SYBR Green master mix (Cat No. 203402, Exiqon). mRNA PTEN was detected using KAPA SYBR FAST One-Step qRT-PCR KIT Universal, All instructions according to the manufacturer's instructions.

Quantitative real-time PCR

Total RNA from blood plasma was extracted using the miRCURY RNA Isolation Kit-Biofluid (Cat No. 300112, Exiqon). Complementary DNA was prepared from DNAse-treated RNA samples with Universal cDNA Synthesis kit II, 8-64 rxns (Cat. No. 203301, Exiqon). Quantitative PCR was performed on a StepOnePlus real-time PCR system (Applied Biosystems) using Excellent SYBR Green master mix (Cat No. 203402, Exiqon). mRNA PTEN was detected using KAPA SYBR FAST One-Step qRT-PCR KIT Universal

Data analysis

Data have been analyzed with comparative quantitative, 2ΔΔCt method, using miR-16 and beta-actin Ct to reference gene.

3. Results

Table 1 describes the expression of miR-141 and mRNA PTEN in the sample. The expression of miR-141 has been upregulated after cisplatin therapy, but the expression of mRNA PTEN have been downregulated after therapy. Its indicated that the therapy was not responded.

Table 1

The expression of miR-141 and mRNA PTEN in blood plasma sample by Fold Change (2ΔΔCt method).


Sample Before treatment After treatment
miR-141 1.49 0.61
mRNA PTEN 0.69 0.5

NPC happen because of EBV genome insertion. Then we conducted interaction between EBV-miR with mRNA PTEN by in silico study with Vienna Package Software (Figure 1). The study has been done for investigated the reason of down-regulated of mRNA PTEN after therapy. All of EBV-miR have been targeted mRNA PTEN, which means that its interaction may cause the down-regulated of mRNA PTEN.

fig-1.jpgfig-2.jpg
Figure 1

mRNA PTEN-EBV-miR interaction by Vienna Package Software (Green: PTEN. Red: EBV-miR). The strongest interaction was seen in PTEN-EBV-Bart10-5p (MFE=–95.90 kcal · mol 1 ).

fig-3.jpg

4. Discussion

miR-141 have been investigated as oncomir by down-regulated mRNA PTEN in blood plasma NPC. PTEN plays a role in conducting dephosphorylation of PIP3 into PIP2 on Akt phosphorylation of PI3K pathway [9]. However, miR-141 as oncomir can inhibit the expression of PTEN in post-transcriptional processes. The expression of oncomir also decreased after drugs therapy, which it can increase the expression of mRNA targetted. However, the expression of mRNA PTEN was upregulated after therapy although the expression of miR-141 was down-regulated. It has meant that the therapy was not responded and there might be cisplatin resistance.

In cellular respond, cisplatin can be interacted with secondary thiols, like glutathione and metallothionein. Glutathione-cisplatin conjugated exit from the cell by ATP- dependent pump. After cisplatin interacted with DNA, it will inhibit proliferation by activated DNA damage. Kinase such as Akt, PKC, and ERK is also involved in the regulation of cell death that induced by cisplatin. miR-214 was promoted cisplatin resistance by downregulating PTEN and Akt [11]. miR-141 might be promoted cisplatin resistance by downregulating PTEN and Akt activated similar as miR-214.

The inhibition in mRNA PTEN by another oncomir, like EBV-miR, makes mRNA PTEN down-regulated and not responded to cisplatin therapy. miRNA-miRNA interaction may be potential on complex network regulation of biological processed [12]. Another miRNA can influence any miRNA by regulated their targeted and modulated their activity [13].

5. Conclusions

miR-141 is one of the important factors in cisplatin drugs resistance through inhibition of mRNA PTEN and Akt activated signaling. mRNA PTEN in NPC might be bound to EBV-miR that makes mRNA PTEN down-regulated and not responded to cisplatin therapy

Acknowledgments

Authors thank the Ministry of Research, Technology, and Higher Education of the Republic of Indonesia for research funding awarded Dharmais Cancer Hospital [Grant Number: UGM/219/LPPM/2015] for providing the samples and also Genomirs Research Team.

References

1 

Robbins SL, Kumar V. Buku ajar patologi I. [Basic pathology part I]. Penerbit Buku Kedokteran EGC. Jakarta; 2012. p.225. [in Bahasa Indonesia]. http://kink.onesearch.id/Record/IOS3737.SULUT000000000001352

2 

Young LS, Dawson CW. Eipstein-Barr virus and nasopharyngeal carcinoma. Chin J Cancer 2014; 33(12):581. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4308653/

3 

Gan GS. Farmakologi dan terapi edisi 5. [Pharmacology and therapy 5 th Ed] Departemen Farmakologi dan Terapeutik, FK UI; 2009. p. 746. [in Bahasa Indonesia]. http://kink.onesearch.id/Record/IOS8.DEPKES-OAIββ:3316

4 

Basu A, Krishnamurthy S. Cellular responses to cisplatin-induced DNA damage. [Review Article]. Journal of Nucleic Acid. 2010;2010:1–16. urlββhttps://www.hindawi.com/journals/jna/2010/201367/

5 

Svoronos AA, Engelman DM, Slack FJ. OncomiR or tumor suppressor? The duplicity of microRNAs in cancer. Cancer Res. 2016;76(13):3666. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4930690/

6 

Zhang L, Deng T, Li X, Liu H, Zhou H, Ma J, Wu M, et al. MicroRNA-141 is involved in a nasopharyngeal carcinoma related genes network. Carcinogenesis 2010;31(4):564. https://www.ncbi.nlm.nih.gov/pubmed/20053927

7 

Imanaka Y, Tsuchiya S, Sato F, Shimada Y, Shimizu K, Tsujimoto G. MicroRNA-141 confers resistance to cisplatin-induced apoptosis by targeting YAP1 in human esophageal squamous cell carcinoma. 2011;56(4):270https://www.ncbi.nlm.nih.gov/pubmed/21289630

8 

Jaarsveld MT, Helleman J, Boersma AW, van Kuijk PF, van Ijcken WF, Despierre E, Vergote I, et al. miR-141 regulates KEAP1 and modulates cisplatin sensitivity in ovarian cancer cells. Oncogene. 2013; 32(36):4284. https://www.ncbi.nlm.nih.gov/pubmed/23045278.

9 

Ching-Chuan K, Jang-Yang C, Yen-Ting C, Hung-Jie W, Wan-Shu L, Huang-Hui C, Chi-Yen C et al. Activation of Akt/FoxO axis confers resistance to cisplatin in human nasopharyngeal carcinomas. In: Proceedings of the 102nd Annual Meeting of the American Association for Cancer Research; 2011 Apr 2-6; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2011;71(8):1701. http://cancerres.aacrjournals.org/content/71/8_Supplement/1701

10 

Vinciguerra M, Fabio C, Marion P, Sebastian C, Roberto M, Roberto B, Michelangelo F. Unsaturated fatty acids promote hepatoma proliferation and progression through downregulation of the tumor suppressor PTEN. Journal of Hepatology 2009;50:1139. https://www.ncbi.nlm.nih.gov/pubmed/19398230

11 

Chalhoub N, Baker SJ. PTEN and the PI3-Kinase Pathway in Cancer. Annu Rev Pathol. 2009;4:127–150. https://www.ncbi.nlm.nih.gov/pubmed/18767981

12 

Guo L, Su B, Wu Q, Yang S, Chen F. miRNA-miRNA interaction implicates for potential mutual regulatory pattern. Gene 2012:511(2):194. https://doi.org/10.1016/j.gene.2012.09.066.

13 

Alshalalfa M. MicroRNA response element-mediated miRNA-miRNA interactions in Prostate Cancer. Hindawi Publishing Corporation. Advances in Bioinformatics 2012: 2012:1–10 https://www.ncbi.nlm.nih.gov/pubmed/23193399

FULL TEXT

Statistics

  • Downloads 5
  • Views 37

Navigation

Refbacks



ISSN: 2413-0877